Primer | Nucleotide sequence (5¢®3¢) | Thermocycling conditions |
matK_XF1 matK_MALP_R1 | TAATTTACGATCAATTCATTC ACAAGAAAGTCGAAGTAT | 94˚C for 4 min, 40 cycles of 94˚C for 50 s, 52˚C for 1 min, and 72˚C for 1 min, 72˚C for 10 min |
rbcLa F rbcLa R | ATGTCACCACAAACAGAGACTAAAGC CTTCTGCTACAAATAAGAATCGATCTC | 94˚C for 1 min, 30 cycles of 94˚C for 45 s, 51˚C for 45 s, and 72˚C for 5 s, 72˚C for 5 min |
rpoB F rpoB R | ATGCAACGTCAAGCAGTTCC GATCCCAGCATCACAATTCC | 94˚C for 4 min, 40 cycles of 94˚C for 30 s, 53˚C for 40 s, and 72˚C for 40 s, 77˚C for 7 min |
rpoC1-1F rpoC1-3R | GTGGATACACTTCTTGATAATGG TGAGAAAACATAAGTAAACGGGC | 94˚C for 4 min, 40 cycles of 94˚C for 30 s, 53˚C for 40 s, and 72˚C for 40 s, 72˚C for 7 min |
atpF-atpH F atpF-atpH R | AACTCGCACACACTCCCTTT GGRGTTGGTCAAGGTACTGC | 94˚C for 3 min, 35 cycles of 94˚C for 30 s, 51˚C for 40 s, and 72˚C for 40 s, 72˚C for 10 min |
psbK-psbI F psbK-psbI R | TTAGCATTTGTTTGGCAAG AAAGTTTGAGAGTAAGCAT | 95˚C for 2 min 30 s, 35 cycles of 95˚C for 30 s, 51˚C for 1 min, and 72˚C for 1 min, 72˚C for 10 min |